Cloning & Primer Design

🧬 Interactive Cloning & Primer Design

Design primers, simulate PCR, restriction digestion, and ligation.

1Input Sequence

2Enzymes & Vector

3Results & Map

Step 1: Enter your DNA sequence

Paste the coding sequence (CDS) of your gene of interest below.

DNA Sequence (5'→3') ATGGCTAGCGTAGCTAGCTAGCATG

Step 2: Choose restriction enzymes & vector

Forward restriction enzyme EcoRI (GAATTC) HindIII (AAGCTT) BamHI (GGATCC) XbaI (TCTAGA) NotI (GCGGCCGC) SacI (GAGCTC) KpnI (GGTACC) SmaI (CCCGGG)

Reverse restriction enzyme HindIII (AAGCTT) EcoRI (GAATTC) BamHI (GGATCC) XbaI (TCTAGA) NotI (GCGGCCGC) SacI (GAGCTC) KpnI (GGTACC) SmaI (CCCGGG)

Vector backbone pUC19 (2686 bp) pET28a (5369 bp) pGEX-4T-1 (4969 bp) pcDNA3.1 (5428 bp) pEGFP-N1 (4733 bp) pLenti (7.2 kb)

Step 3: Results

🧪 Primers Designed

🧬 PCR Simulation

✂️ Restriction Digestion

🔗 Ligation & Plasmid Map